Created
May 5, 2020 06:07
-
-
Save ferbass/19e46395a6f6b847babb2d824ceaa5ed to your computer and use it in GitHub Desktop.
1.3 Hidden Messages in the Replication Origin (Part 2)
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
# Copy your updated FrequentWords function (along with all required subroutines) below this line | |
def FrequentWords(Text, k): | |
FrequentPatterns = [] # output variable | |
# your code here | |
Count = CountDict(Text, k) | |
m = max(Count.values()) | |
for i in Count: | |
if Count[i] == m: | |
FrequentPatterns.append(Text[i:i+k]) | |
FrequentPatternsNoDuplicates = remove_duplicates(FrequentPatterns) | |
return FrequentPatternsNoDuplicates | |
def remove_duplicates(Text): | |
ItemsNoDuplicates = [] # output variable | |
# your code here | |
for item in Text: | |
if item not in ItemsNoDuplicates: | |
ItemsNoDuplicates.append(item) | |
return ItemsNoDuplicates | |
def CountDict(Text, k): | |
Count = {} # output variable | |
# your code here | |
for i in range(len(Text)-k+1): | |
Pattern = Text[i:i+k] | |
Count[i] = PatternCount(Pattern, Text) | |
return Count | |
def PatternCount(Pattern, Text): | |
count = 0 # output variable | |
for i in range(len(Text)-len(Pattern)+1): | |
if Text[i:i+len(Pattern)] == Pattern: | |
count = count+1 | |
return count | |
def FasterSymbolArray(Genome, symbol): | |
array = {} | |
n = len(Genome) | |
ExtendedGenome = Genome + Genome[0:n//2] | |
array[0] = PatternCount(symbol, Genome[0:n//2]) | |
for i in range(1, n): | |
array[i] = array[i-1] | |
if ExtendedGenome[i-1] == symbol: | |
array[i] = array[i]-1 | |
if ExtendedGenome[i+(n//2)-1] == symbol: | |
array[i] = array[i]+1 | |
return array | |
k = 10 | |
# Now set Text equal to the Vibrio cholerae oriC and k equal to 10 | |
Text = 'ATCAATGATCAACGTAAGCTTCTAAGCATGATCAAGGTGCTCACACAGTTTATCCACAACCTGAGTGGATGACATCAAGATAGGTCGTTGTATCTCCTTCCTCTCGTACTCTCATGACCACGGAAAGATGATCAAGAGAGGATGATTTCTTGGCCATATCGCAATGAATACTTGTGACTTGTGCTTCCAATTGACATCTTCAGCGCCATATTGCGCTGGCCAAGGTGACGGAGCGGGATTACGAAAGCATGATCATGGCTGTTGTTCTGTTTATCTTGTTTTGACTGAGACTTGTTAGGATAGACGGTTTTTCATCACTGACTAGCCAAAGCCTTACTCTGCCTGACATCGACCGTAAATTGATAATGAATTTACATGCTTCCGCGACGATTTACCTCTTGATCATCGATCCGATTGAAGATCTTCAATTGTTAATTCTCTTGCCTCGACTCATAGCCATGATGAGCTCTTGATCATGTTTCCTTAACCCTCTATTTTTTACGGAAGAATGATCAAGCTGCTGCTCTTGATCATCGTTTC' | |
# Finally, print the result of calling FrequentWords on Text and k. | |
print (FrequentWords(Text, k)) |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment