Last active
March 31, 2021 13:47
-
-
Save claraj/0dea4bef2e9ac5e84462b4dbdb4ffe2c to your computer and use it in GitHub Desktop.
Python bioinformations 101
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
# Example of real-world use of Python string manipulation - DNA analysis | |
# | |
# DNA is made of ATGC | |
# | |
# A-T are always paired | |
# G-C are always paired | |
# | |
# So if you have a sequence of one side of a DNA molecule, can you use Python to generate the other side? | |
# | |
dna1 = 'accagtaccagtgt' | |
dna2 = 'gtacaccaggtcta' | |
# Remember | |
# a pairs with t | |
# c pairs with g | |
# so for dna1, it begins acca... so output string will start tggt... | |
# In DNA, the ATCG are codes for generating proteins (you are made of 100's of different kinds of proteins). | |
# Most of your DNA doesn't appear to make proteins - only about 1% of it encodes protein. | |
# A part of DNA that encodes a protein is called a gene So how do you find which parts do, | |
# or where are your genes in your DNA? | |
# | |
# So biologist are interested in where certain codes are. One code is | |
# ATG is called a 'start codon' and that means 'start making a protein here' | |
# | |
# Does string 1 have any genes in it? | |
# Does string 2 have any genes in it? | |
# | |
# If so, what's the index of where that gene is? | |
dna3 = 'acgatggatacgcgggagctattcatctgtgttgagaaacaccggagaacttattggtctgtcaagattgcgactgtggtatagctcacccggtcgcggctttctagt' \ | |
'tagtggccagctcccgtgtatttggaagctgagagaaggacccctgtggttcgaatcagctcacgagcgctggcacaccgcaatcagccggctaataaaattcgtatg' \ | |
'gactgccccacacaagaagacggtaaatttatcaacactatagttgctatacaccaggagcgagcgtaaatttgtagcggtcagattaacttgctgggaatgaaccat' \ | |
'tgtcgccctctgcagcaagttagatggcatgattggtactgcccttcactggtagcagctccccctgtaatatatccgtggccactattcaagggctcaaataggcga' \ | |
'ccatgagagaccattataggcggtacagcgatggtaggtttgcctgggcagatatcgttagccccttctgcgcgctataagatagcgaaggataattctgcgggacca' \ | |
'tggtcgtctcctaacctcagggtgggattcctggcaggtggaccgggcgcgcatcgagagcattcggggttcctaccagccagggaaatcgggtcgaccactaggcaa' \ | |
'tgagcggctcacaccgattttcttaagagacgtaacaaagcccgcatgaacggctggagtgaatcaccgtacgactacctaagcctcattgggatccactgtaaaccc' \ | |
'cttcgccggtgttgggtgtccgcaacgcctctgctttttgcgtacagtcggcgtggtggagtccgcggccatactggcggatggtttgtagaacagtgtaacgatgtg' \ | |
'tgtcactgccccccgtagcttctattgccatgtttgggaggttctataggggttacagagtagttttaagttttagcacgacagcaccagtattgccagtgatgccgt' \ | |
'tgaggccgcaaaagtgattaacccccgtgggaccggatacgttcccagcggcaatccttgtcttaccgccggactgcggagcgaagggagaagtaaccgtggtaatta' | |
dna4 = 'cagagcaatgtctgttagataatctctcgtctggatagcgagaagtttccggaagacgattgtttccaacgaaagggctgataactacactctgtcgcgcttctttcg' \ | |
'tgttcgccatgggcacattggtttaaaagtgatctcgagagacgttttcatgacttgttgtgttatatcaacgtaacttttaagtcatattttctccctaccccagac' \ | |
'tagatgggttcctttcatcgtccaccgagttgcttacgagcaugacacttagccggggaaaatgttcgcaatgttccgcgacagcgtcaggtgtcaaacagaaagcga' \ | |
'aggccgccgtgtaacggagaattgtgggcgcagtcaaatagctaattattgggaaaggccatgtggagtccgtcagcggaacagcctgggcggacgcgctgccgctcg' \ | |
'ttcacctcgcctgccttcgtgttggggaccggatacgttcccagcggcaatccttgtcttaccgccggactgcggagcgaagggagaagtaaccgtggtaattagcga' \ | |
'gagaccgttgaggcgcggggcgatccgcccttgagtggactccaaacacattcgacgaaggggtgggaacataagttaattggagggtcggggaagtcccacgcccgg' \ | |
'tccctacatgattgcacatagttcgttcaccaacgggcgatcttcctcacactagaggaacgagtagtactccagacattgagtcagttgcagaccaagtggagggaa' \ | |
'cgatttttaugggccgctcaggtactagtgctagaatgcctacaaacggcactggtgacccgctcccgagtttgcgctgttacgtgtcccttaaagtatacttcgatc' \ | |
'aacatggcggccatacgacgcttaaatatttcaccagttgtgtttcgcgcauggagttgttctgtgttatcggcgagtctccattgcacgtcatcaactaaaaaccac' \ | |
'ggccacacagacatgccttgattcttcccgcgatggtaggtttgcctgggcagatatcgttagccccttctgcgcgctataagatagcgatggtaggtttaactatca' |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment